Presence of two Lactobacillus and Bifidobacterium probiotic strains in the neona...
Collect this paper and discover other ones on Labmeeting. Learn more.
Found Fulltext for This Paper:
Fulltext for PDF in Flash Viewer:
The ISME Journal (2008) 2, 8391 & 2008 International Society for Microbial Ecology All rights reserved 1751-7362/08 $30.00 www.nature.com/ismej ORIGINAL ARTICLE Presence of two Lactobacillus and Bifidobacterium probiotic strains in the neonatal ileum Rebecca Wall1,2,3, Seamus Gerard Hussey4,5, C Anthony Ryan4, Martin O��eill5, Gerald Fitzgerald2,3,1,2, Catherine Stanton1,2 and R Paul Ross1,2 Department of Biotechnology, Teagasc, Moorepark Food Research Centre, Fermoy, Co. Cork, Ireland; Alimentary Pharmabiotic Centre, Cork, Ireland; 3Department of Microbiology, University College, Cork, Ireland; 4Erinville Hospital and Department of Paediatrics and Child Health, University College, Cork, Ireland and 5Department of Paediatrics, Mayo General Hospital, Castlebar, Mayo, Ireland 2 1 The overall purpose of this study was to examine the lactobacilli and bifidobacteria microbiota in the human ileum at a very early stage of life. Ileostomy effluents from two infants, taken at different time points, were plated on Lactobacillus selective agar and cys-MRS containing mupirocin to select for bifidobacteria. In one case, a stool sample following ileostomy reversal was subsequently analyzed microbiologically. Pulse-field gel electrophoresis and 16S rRNA sequencing was used to investigate the cultivable population of bifidobacteria and lactobacilli and denaturing gradient gel electrophoresis (DGGE) to examine the non-cultivable population. The probiotic strain, Lactobacillus paracasei NFBC 338, was recovered at both time points from one of the infants and dominated in the small intestine for a period of over 3 weeks. Moreover, the probiotic strain, B. animalis subsp. lactis Bb12, was obtained from the other infant. This study shows the presence of two known probiotic strains in the upper intestinal tract at an early stage of human life and thus provides some evidence for their ability to colonize the infant small intestine. The ISME Journal (2008) 2, 8391; doi:10.1038/ismej.2007.69; published online 6 December 2007 Subject Category: microbial population and community ecology Keywords: Bifidobacterium; colonization; genomic diversity; human gastrointestinal tract; ileostomy; lactobacillus Introduction The gastrointestinal tract of the fetus is initially sterile, but microbes from the mother and the surrounding environment colonize the gut of the term infant following delivery until a dense and complex microbiota develops. In full-term vaginally delivered infants, colonization starts immediately after delivery and microorganisms such as enterobacteria and streptococci appear in feces. In addition, the composition of the gut microbiota is influenced by the diet of the infant. Breastfeeding positively influences gut colonization with bifidobacteria, whereas formula-fed infants have been reported to have a more diverse microbiota, including bifidobacteria, bacteroides, clostridia and streptococci (Mitsuoka, 1996; Favier et al., 2002). Furthermore, the gut flora of preterm infants differs from term infants for several reasonsimmature gut motility, delayed Correspondence: RP Ross, Teagasc, Biotechnology Centre, Moorepark, Fermoy, Co. Cork, Ireland. E-mail: paul.ross@teagasc.ie Received 11 April 2007; revised 5 July 2007; accepted 9 July 2007; published online 6 December 2007 onset of enteral nutrition, the extensive use of broad-spectrum antibiotics, barrier nursing and hygiene practices, and the relatively aseptic neonatal intensive care environment. These factors can lead to colonization by facultatively anaerobic bacteria, whereas colonization by bifidobacteria is often delayed (Stark and Lee, 1982a, b; Gewolb et al., 1999). The influence of intestinal bacteria on human health can be considered harmful, beneficial or neutral. Bifidobacterium spp and Lactobacillus species are among those microorganisms believed to be beneficial and can contribute to digestion, immune stimulation and inhibition of pathogens (Fuller, 1989). Members of the genus Bifidobacterium are present in large numbers in newborn infants and are considered to be of importance in early infancy (Tannock, 1994; Chierici et al., 2003). The most common Bifidobacterium species in infants have been reported to be Bifidobacterium infantis, Bifidobacterium breve and Bifidobacterium longum (Matsuki et al., 1999; Malinen et al., 2002). As infants mature, B. infantis and B. breve are replaced by Bifidobacterium adolescentis and B. longum (Matsuki et al., 1999). Lactobacillus colonization is Lactobacilli and bifidobacteria flora in infant ileum R Wall et al 84 less well understood and studies report low colonization rates in Western countries (Stark and Lee, 1982a, b; Matsumiya et al., 2002). Lactobacillus acidophilus, Lactobacillus salivarius, Lactobacilli casei, Lactobacillus plantarum, Lactobacillus fermentum, Lactobacillus reuteri and Lactobacillus brevis have been the most commonly isolated species from the human intestine (Mitsuoka, 1992). The Lactobacillus species that are most commonly found in infant feces are L. acidophilus, L. salivarius and L. fermentum (Cooperstock and Zedd, 1983; Benno and Mitsuoka, 1986). Studies in germ-free animal models have suggested that colonization of the gastrointestinal tract plays a crucial role in the development of the gut immune system by mechanisms related to the maturation of the intestinal epithelium and immune compartment cells (Umesaki and Setoyama, 2000). In particular, Lactobacillus and Bifidobacterium strains modify in vitro the functional pattern of monocytes and lymphocytes towards increased production of IL-12 and IFN-g, the so-called type 1 cytokines (Th1 cytokines). Th1 cytokines function to help defend against a viral or bacterial attack in the blood and tissues because Th1 cytokines instruct the immune system to produce cells and antibodies that are especially effective against such infections. Bifidobacterium and Lactobacillus are frequently used as probiotics for human consumption (Fuller, 1989). The alleged benefits of probiotic consumption include improved gastrointestinal health, antitumor, anti-infective, immunomodulatory and motility effects (Mitsuoka, 1992; Sanders, 1994; Lee and Salminen, 1995; Aimutis, 1999). Adhesion and colonization (albeit transient) of probiotic bacteria in the gastrointestinal tract of the host is believed to be one of the most essential features required for delivering their health benefits (Bernet et al., 1994). Preterm infants represent a special situation for probiotics as such subjects have immature organs, often receive intensive care, experience delayed feeding and frequently treated are with broad-spectrum antibiotics shortly after birth (Zhang et al., 2005). Molecular biological methods are increasingly being applied to study the gastrointestinal tract ecology (Tannock, 2001). Denaturing gradient gel electrophoresis (DGGE) analysis is one of the most suitable and widely used methods for studying complex bacterial communities in various environments (Muyzer and Smalla, 1998). Total bacterial DNA from the habitat of interest is extracted, and subsequent processing is used to generate a ��enetic fingerprint��of the community (Walter et al., 2001). Using DGGE, it is possible to identify constituents that represent only 1% of the total population in the human GI tract (Muyzer et al., 1993). More recently metagenomic approaches have been used to explore the complex microbial community within the GIT (Tringe et al., 2005). It has been established that microbiota patterns differ between stomach, upper small bowel, lower The ISME Journal small bowel and rectum in healthy adults (Flourie et al., 1986; Evans et al., 1988; Marteau et al., 1994; Evans, 1998). However, it is not known if surgical interruption of the developing intestinal ecosystem in the infant with an ileostomy results in modification of expected microbiota or adaptation of the neoterminal ileum to yield a microbiota pattern similar to that of the infant colon. The aim of this study was to examine the lactobacilli and bifidobacteria microbiota in the human ileum at a very early stage of life. Materials and methods Subjects ��nfant D��was a preterm infant who had complex medical complications of prematurity. Medical therapy for a patent ductus arteriosis was followed by spontaneous intestinal perforation. This required laparotomy, perforation repair and creation of an ileal stoma. ��nfant K��was a term infant who developed early intestinal obstruction that required surgical management and formation of an ileal stoma in the first week of life. Further investigation revealed that the infant had cystic fibrosis. The ileostomy was reversed and intestinal continuity restored at 39 weeks of age. Four ileostomy samples were taken from the two infants, from infant D at 50 and 74 days old and from infant K at 24 and 31 weeks old. A fecal sample was also taken from infant K at age 44 weeks following ileostomy reversal. The diet of infant K did not change between the pre- and postoperative periods. Both infant D and infant K were vaginally delivered and were both breast- and formula-fed. None of the infants received probiotics in their diet. We have no information regarding whether or not the mother received probiotics. Infant D was treated with antibiotics (metronidazole) for the first 3 weeks of life and between days 50 and 60. Fully informed consent was obtained from all parents. Intestinal content sampling The swab samples taken did not allow accurate enumeration of bacteria (quantitative assessment) but did allow the isolation of strains from the samples (qualitative assessment). Samples were stored at 51C and delivered to the laboratory for processing within 5 h of sampling or stored at 201C for DNA extraction. The swabs were vortex mixed and serially diluted in maximum recovery diluent (MRD, Oxoid Ltd, Hampshire, UK). Growth conditions and selection of colonies Serial dilutions of the samples were pour-plated onto Lactobacillus selective agar (LBS) (Becton Dickinson Co., Cockeysville, MD, USA) and modified de Man, Rogosa and Sharpe (MRS) agar (mMRS) supplemented with 0.05% (w/v) L-cysteine hydrochloride (98% pure; Sigma Chemical Co., St Louis, MO, USA). To preselect for bifidobacteria, Lactobacilli and bifidobacteria flora in infant ileum R Wall et al 85 100 mg of Mupirocin (Oxoid) per ml was added to the mMRS medium as antimicrobial susceptibility disks by using the disk diffusion method (Rada, 1997). Agar plates were incubated anaerobically (anaerobic jars with Anaerocult A gas packs; Merck, Darmstadt, Germany) at 371C for 72 h. Twenty colonies were randomly selected from each sample, which would represent the predominant strains comprising the population in the sample. These colonies were subcultured in mMRS broth for 24 to 48 h. Pulse-field gel electrophoresis subsequent steps in the plasmid isolation procedure and vertical gel electrophoresis are identical to those described by Anderson and McKay (1983). Plasmids isolated from Lactococcus lactis DRC3 were used as standard molecular weight sizes as described previously (Desmond et al., 2005). PCR-DGGE analysis (Bifidobacterium) High-molecular-weight DNA was isolated from stationary-phase cultures using previously described procedures (Simpson et al., 2003). The restriction enzymes ApaI, XbaI or SpeI (New England Biolabs, Beverly, MA, USA) were used for genomic digests, which were resolved with a contour-clamped homogeneous electric field CHEF-DR III pulsed-field system (Bio-Rad Laboratories, Richmond, CA, USA) at 6 V cm1 for 18 h with a 1- to 15-s linear ramp pulse time and with 0.5 Tris base-borateEDTA running buffer maintained at 141C. Gels were stained in distilled water containing 0.5 mg of ethidium bromide per ml for 30 min and then destained for 60 min. Pulsed-field gel electrophoresis (PFGE) gels were visualized by ultraviolet (UV) transillumination, and the sizes of the PFGE fragments were estimated by comparison with a lowrange PFGE marker ranging from 2.03 to 194 kb (no. N0350S; New England Biolabs). 16S rRNA sequencing Two 16S ribosomal RNA (rRNA) primersCO1 for the 50 end (50 -AGTTTGATCCTGGCTCAG-30 ) and CO2 for the 30 end (50 -TACCTTGTTACGACT-30 )were used to generate an approximate 1.5-kb 16S rRNA product under PCR conditions described previously (Simpson et al., 2003). This product was partially sequenced by using the primer CO1 by LARK technologies (Essex, UK). Comparison of the 16S rRNA sequences obtained by using the BLAST program allowed the assignment of a strain to a particular species. In general, when 16S rRNA similarity values exceed 98%, the strains are considered to belong to the same species (Stackebrandt and Goebel, 1994). Plasmid profiling Plasmid DNA was isolated by the method of Anderson and McKay (1983), with one minor adjustment at the lysis step. Briefly, the culture was inoculated (2% v/v) and grown for approximately 4 h. The cells were harvested (6000 g for 20 min) and resuspended in lysis solution ((sucrose (6.7% w/v), Tris (50 mM) and EDTA (1 mM) at pH 8)), supplemented with lysozyme (Sigma Chemical, Poole, UK) and Mutanolysin (Sigma) (20 mg ml1 each), and incubated for 30 min at 371C. All Bacterial DNA was extracted from swabs using a QIAamp DNA stool minikit (Qiagen, Hilden, Germany) by following the manufacturer�� instructions (lysis temperature, 951C). To investigate the bifidobacterial population in the samples, the PCR was performed as a nested approach. The first PCR applied primers Im26-f (50 -GATTCTGGCTCAGGAT GAACG-30 ) and Im3-r (50 -CGGGTGCTICCCCACTTT CATG-30 ) described by Kaufmann et al. (1997), amplified a 1417-bp fragment of the bifidobacterial 16S rRNA gene. PCR volumes of 50 ml contained 5 ml of 10 PCR buffer, 5 ml of MgCl2 (2.5 mM), 8 ml of deoxynucleoside triphosphates (dNTPs) (0.2 mM each), 1 ml of each primer (5 pmol), 0.5 ml of Taq polymerase (5 U ml1), 28.5 ml of sterile Milli-Q water and 1 ml of DNA solution. The following PCR program was used: initial denaturation at 941C for 5 min; three cycles of denaturation at 941C for 45 s, annealing at 571C for 2 min and extension at 721C for 1 min; 30 cycles of denaturation at 941C for 20 s, annealing at 571C for 1 min, extension at 721C for 1 min and final extension at 721C for 5 min, followed by cooling to 41C. The presence of PCR products was verified on a 1.5% agarose gel. To eliminate the remaining oligonucleotides and original template DNA, purification of the amplicons was performed by use of the QIAquick PCR purification kit (Qiagen, Hilden, Germany) according to the manufacturer�� instructions. A second PCR was performed using the amplicons of the first PCR as template DNA. The primer set used (F357-GC and 518R) (50 GC-clampGCCTACGGAGGCAGCAG-30 and 50 -ATTACCGCGG CTGCTGG-30 , respectively) amplifies the V3 region of the bacterial 16S rRNA gene (Muyzer et al., 1993). The forward primer contained a GC clamp (50 CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCAC GGGGG-30 ) to facilitate separation of the amplicons in a DGGE gel. PCR volumes of 50 ml contained 5 ml of 10 PCR buffer, 2 ml of MgCl2 (1 mM), 8 ml of dNTPs (0.2 mM each), 2 ml of each primer (5 mM), 0.5 ml of Taq polymerase (5 U ml1), 29.5 ml of sterile Milli-Q water and 1 ml of 10-fold diluted DNA solution (obtained from the first PCR). The following PCR program was used: initial denaturation at 941C for 5 min, 30 cycles of denaturation at 941C for 20 s, annealing at 581C for 45 s, extension at 721C for 1 min and final extension at 721C for 7 min, followed by cooling to 41C. PCR products were analyzed on DGGE gels on the basis of the protocol of Temmermann et al. (2003). A Dcode universal mutation detection system (Bio-Rad, Hercules, CA, USA) was used, utilizing 16-cm by 16-cm by 1-mm gels. Eight The ISME Journal Lactobacilli and bifidobacteria flora in infant ileum R Wall et al 86 percent polyacrylamide gels were prepared and run with 1 Tris-acetate-EDTA (TAE) buffer diluted from 50 TAE buffer (2 M Tris base, 1 M glacial acetic acid and 50 mM EDTA). The denaturing gradient was formed with two 8% acrylamide (acrylamide-bis/ acrylamide 40%) stock solutions (Severn Biotech Ltd, Kidderminster, UK). A 100% denaturing solution contained 40% (v/v) formamide and 7.0 M urea. The gels were poured from the top by using a gradient maker (CBS Scientific Linear Gradient Maker, Bio-Rad) and a pump (Bio-Rad), and gradients of 5070% were used for the separation of the generated amplicons. Before polymerization of the denaturing gel (24-ml gradient volume), a 6-ml stacking gel without denaturing chemicals was added and the appropriate comb was subsequently inserted. PCR amplicons were separated by electrophoresis at a constant voltage of 60 V in a 0.5 TAE buffer at a constant temperature of 601C for 16 h. Gels were stained in ethidium bromide for 30 min, allowing digital capture of the DGGE band profiles under UV light. colonization of Bifidobacterium and Lactobacillus in the distal small intestine at an early stage of life. Hence, the underlying purpose of the study was to gain a better understanding of the developing intestinal ecosystem in the neonate, which may hold the key to prevention of several important diseases. Culture-based isolations were further compared with culture-independent results using DGGE. Isolation and genetic fingerprinting using PFGE PCR-DGGE analysis (Lactobacillus) Amplification was performed using a DNA Thermal Cycler (Eppendorf Mastercycler gradient 5331, Hamburg, Germany) and the specific primers Lac1 (50 -AGCAGTAGGGAATCTTCCA-30 ) and Lac2GC (50 GC-Clamp-ATTYCACCGCTACACATG-30 ) (Walter et al., 2001). PCR volumes of 50 ml contained 5 ml of 10 PCR buffer, 1.5 ml of MgCl2 (1.5 mM), 0.5 ml of dNTPs (0.2 mM each), 0.25 ml of each primer (5 pmol), 0.25 ml of Taq polymerase (5 U ml1), 41.25 ml of sterile Milli-Q water and 1 ml DNA solution. The following PCR program was used: initial denaturation at 941C for 2 min, 35 cycles of denaturation at 941C for 30 s, annealing at 611C for 1 min, extension at 681C for 1 min and final extension at 681C for 7 min, followed by cooling to 41C. The presence of PCR products was verified on a 1.5% agarose gel. To eliminate the remaining oligonucleotides and original template DNA, purification of the amplicons was performed by use of the QIAquick PCR purification kit (Qiagen, Hilden, Germany) according to the manufacturer�� instructions. DGGE analysis of PCR amplicons generated with primers Lac1 and Lac2 was performed essentially as described for bifidobacteria but with the following modifications; the gels contained a 3050% gradient of urea and formamide increasing in the direction of electrophoresis. Infant D. For each ileostomy sample, 20 isolates were selected at random from lactobacilli selective plates. These isolates represented the predominant strains comprising the populations in the samples. To genetically fingerprint the isolates, genomic digestion with the restriction enzyme ApaI and PFGE was used. The isolates from the first time point (50 days old) isolated on LBS produced one macro restriction pattern (Figure 1a). The same occurred with the isolates from the second time point (74 days old), which also produced one macro restriction pattern (Figure 1b). When the macro restriction patterns for the two time points were compared, these were identical, indicating that the same strain survived in the microbial niche over the 3-week period. This strain was identified as Lactobacillus paracasei according to 16S rRNA sequencing. Interestingly, this strain exhibited the same PFGE pattern as the probiotic strain Lactobacillus paracasei NFBC 338 (Figure 1c) (Gardiner et al., 1998, 2000; Desmond et al., 2005). This was further confirmed by plasmid profiling (Figure 1d). On the basis of selection on MRS containing cysteine hydrochloride (0.5 g l1) and mupirocin (50 mg l1), bifidobacteria appeared to be absent. Infant K. No growth was obtained from the cecal samples following culturing on bifidobacteria-specific media, but when the ileostomy had been reversed it proved to consist of two different strains, which according to 16S rRNA sequencing were most similar to Bifidobacterium animalis subsp. lactis and Bifidobacterium scardovi (Figure 2a). B. animalis subsp. lactis represented 95% of isolates, while the remaining 5% was identified as B. scardovi (Figure 2a). The Bifidobacterium animalis subsp. lactis strain isolated exhibited the same PFGE pattern as the probiotic strain Bifidobacterium animalis subsp. lactis Bb12, following restriction with both XbaI and SpeI (Figure 2b). When the samples were cultured on Lactobacillus selective media, lactobacilli were not obtained in any of the time points instead, there were three different strains of Enterococcus faecium isolated on the lactobacilli selective media from the third time point, which proved that the lactobacilli selective media was not selective entirely for lactobacilli. Interestingly, these macrorestriction patterns of the Enterococcus faecium isolates are very similar, Results In this study, two infants with ileostomies were examined with regard to their lactobacilli and bifidobacteria populations. Ileostomy samples were taken at different time points, and in one case a per-anal stool sample was taken following ileostomy reversal. This allowed us to examine the The ISME Journal Lactobacilli and bifidobacteria flora in infant ileum R Wall et al 87 Figure 1 L. paracasei NFBC 338 is present in the neonatal ileum of infant D. (a) PFGE macro restriction pattern following genomic digests with ApaI of isolates from the first time point (50 days old) and (b) PFGE macro restriction pattern following genomic digests with ApaI of isolates from the second time point (74 days old). (c) Comparison with the macro restriction pattern of the probiotic strain L. paracasei NFBC 338 revealed that the ileum isolates exhibited the same PFGE pattern as L. paracasei NFBC 338. This was further confirmed by plasmid profiling (d). Molecular weight (MW) markers are shown in outside lanes of the gels. PFGE, pulsed-field gel electrophoresis. Figure 2 (a) PFGE macro restriction pattern following genomic digests with XbaI of mMRS-isolates from the third time point, 44 weeks when the ileostomy had been reversed, infant K. (b) PFGE macro restriction pattern following genomic digests with XbaI on B. animalis subsp. lactis strain from infant K (lane 1) and probiotic strain B. animalis subsp. lactis Bb12 (lane 2), which proved indistinguishable from PFGE patterns. SpeI restriction to differentiate the strains, B. animalis subsp. lactis from infant K (lane 3) and B. animalis subsp. lactis Bb12 (lane 4), proving that differentiation was impossible. (c) PFGE macro restriction pattern following genomic digests with ApaI of LBS isolates from the third time point (44 weeks), infant K. Molecular weight (MW) markers are shown in outside lanes. PFGE, pulsedfield gel electrophoresis. The ISME Journal Lactobacilli and bifidobacteria flora in infant ileum R Wall et al 88 suggesting a strong genetic relatedness between the strains (Figure 2c). Detection of lactobacilli and bifidobacteria in ileostomy samples (infant D) using DGGE The primer set Lac1 and Lac2GC resulted in an amplicon for both cecal samples, and DGGE analysis of the PCR-amplified 16S rRNA fragments revealed an identical profile for both the samples, which further matched the migration profile of L. paracasei. Bifidobacterial genus-specific primers were used to amplify a fragment of the 16S rRNA gene. No PCR products were obtained from the cecal samples when using the genus-specific primers Im-3 and Im-26, indicating that either the numbers were below the detection level or that Bifidobacterium species were completely absent in these samples. Comparison of results of DGGE analyses with those of bacteriological culture (infant D) To obtain an insight into the composition of the dominant Lactobacillus species at different time points, 20 colonies were randomly selected from lactobacilli selective plates and subcultured from each time point. These revealed that it was one dominant strain that was the same in both time points and, according to 16S rRNA sequencing, belonged to the species L. paracasei. This cultured species could also be detected by PCR-DGGE where the DGGE profile of these samples matched the profile of L. paracasei (Table 1). Detection of lactobacilli and bifidobacteria in the ileostomy and per-anal stool samples (infant K) using DGGE ing that either the numbers were below the detection level or that the Lactobacillus-like species were absent. The Bifidobacterium-specific primers Im-3 and Im-26 resulted in an amplicon for all samples in this case. These amplicons served as template DNA for the V3 primer combination V3R and V3F during a second PCR step. The mobility of the PCR products obtained by these primers in DGGE was compared to the PCR pattern of bifidobacteria reference strains. Because of the high G C content of bifidobacteria, the conventional 3570% denaturing gradient was replaced with a 5070% denaturing gradient. DGGE of rRNA gene amplicons revealed that there were three amplicons associated with each sampling time, which were identified as Bifidobacterium bifidum, B. longum, Bifidobacterium scardovi and Bifidobacterium animalis, when compared to the migration distances of the reference strains (Figure 3). The reference strains B. scardovi and B. animalis showed the same migration distance in the gel. As these species were cultured from the samples, they should also be identified by DGGE. These four strains associated with the samples also proved to be the same at all three sampling times. Comparison of results of DGGE analyses with those of bacteriological culture (infant K) No PCR products were obtained from the samples when using the primers Lac1 and Lac2GC, indicat- Although a DGGE profile could be obtained for the cecal samples (Figure 3), bacteria were not cultured on the bifidobacteria selective media from these samples, which indicates that either the strains are non-cultivable by the method used in this study or non-viable. A DGGE profile was also obtained from the per-anal fecal sample, which revealed that this sample contained four different strains, B. bifidum, B. longum, B. animalis and B. scardovi, when compared to the migration distances of the reference strains. In the latter case, two of these strains, B. animalis subsp. lactis and B. scardovi, were also Table 1 Species detected by PCR-DGGE and by culture from infant D and K Infant Sample Bacterial species PCR-DGGE D K Cecal (50 days) Cecal (74 days) Cecal (24 weeks) L. paracasei L. paracasei B. animalis subsp. lactis B. scardovi B. longum B. bifidum B. animalis subsp. lactis B. scardovi B. longum B. bifidum B. animalis subsp. lactis B. scardovi B. longum B. bifidum + + + + + + + + + + + + + + Detected by Culture (no of colonies, out of 20) + (20) + (20) + (19) + (1) Cecal (31 weeks) Fecal (44 weeks) Abbreviation: DGGE, denaturing gradient gel electrophoresis. The ISME Journal Lactobacilli and bifidobacteria flora in infant ileum R Wall et al 89 1 B. breve 2 3 4 5 6 B. longum B. infantis B. bifidum B. animalis subsp. lactis/ B. scardovi B. catenulatum B. adolescentis B. dentium Figure 3 DGGE of bifidobacterial PCR-products (V3-region) from infant K: first time point; cecal sample (lane 4), second time point; cecal sample (lane 5) and third time point; fecal sample (lane 6). The mobility of the PCR products obtained in DGGE was compared to the PCR pattern of reference strains obtained with the same primer set (lanes 1, 2 and 3). DGGE, denaturing gradient gel electrophoresis. obtained by culturing. Table 1 summarizes the comparisons of culture and PCR DGGE results. All of the cultured species could be detected by PCR-DGGE. Discussion A better understanding of the developing neonatal intestinal ecosystem may hold the key to prevention or modification of several important diseases. Adhesion and colonization of probiotic bacteria, such as lactobacilli and bifidobacteria in the gastrointestinal tract of the host, is believed to be one of the essential features required for delivering their health benefits (Bernet et al., 1994). Establishment and maintenance of a ��ormal��intestinal microflora may help abrogate gastrointestinal and other inflammatory conditions (Kalliomaki et al., 2001). This study was designed to examine the lactobacilli and bifidobacteria microbiota in the human ileum at a very early stage of life. Bifidobacterium species are common members in the infant gut, comprising 91% of the total cultivable microflora in breast-fed babies and up to 75% in formula-fed infants (Bennet and Nord, 1987). In this respect it is interesting that Bifidobacteria were not isolated from ileostomy effluents at any time point in the study. They were obtained only by culturing when the ileostomy had been reversed in ��nfant K��and consisted of two different strains, Bifidobacterium animalis subsp. lactis and Bifidobacterium scardovi, according to PFGE and 16S rRNA sequencing. These species are not among the most common Bifidobacterium reported in infants however (Matsuki et al., 1999). Interestingly, the B. animalis subsp. lactis strain isolated is a wellknown commercial probiotic strain, B. animalis subsp. lactis Bb12, based on possessing identical genomic fingerprint patterns. B. animalis subsp. lactis Bb12 has been reported to increase antimicrobial protection in the gastrointestinal tract, to combat infectious and other diseases and so could be an important health adjunct for infants (Juntunen et al., 2001; Prioult et al., 2003). DGGE profiles of this infant showed four different strains of bifidobacteria that were the same at three time points. Apart from B. animalis and B. scardovi, B. longum and B. bifidum were also detected. These two species were not obtained by culturing in any of the time points, indicating that either the strains are non-cultivable with the method used or non-viable. Furthermore, according to DGGE, the colonization pattern did not change following ileostomy reversal. Persistent Bifidobacterium appeared to be absent in ��nfant D��according to both culturing and amplification with Bifidobacterium-specific primers, which could be due to the premature birth and antibiotic treatment of this infant. A single strain of Lactobacillus dominated in the small intestine for a period of over 3 weeks according to both PFGE and DGGE in this infant. This strain was identified as the probiotic strain, L. paracasei, NFBC 338 when compared to the genotype of different L. paracasei strains. This strain has been developed specifically for probiotic cheese applications (Gardiner et al., 1998), and clinical trials have showed that it increases the overall Lactobacillus populations in the adult human gut (unpublished). Repeated isolation of a single strain from the same individual suggests that the strain colonizes and replicates in the gut. Colonization by Lactobacillus strains, however, does not appear to be a common trait in early infancy. A study of Japanese infants revealed that only 2/86 infants harbored the same strain of lactobacilli at 5 days and 1 month of age (Matsumiya et al., 2002). In the study by Ahrne et al. (2005), persistent colonization by a single strain over at least 3 weeks was indicated in 17% of the infants in the first 6 months of life. ��nfant K��did not yield Lactobacillus at any time point by either culturing or DGGE. Heilig et al. (2002) studied the development of the Lactobacillus-like community in infants by PCR on fecal DNA from a baby from delivery (day 1) to 5 months later (day 147) at regular intervals. No PCR products were obtained up to day 55, indicating that the template was absent or that the amount of template was too low to be detected. We are not aware of any previously published studies of the composition of the human neonatal ileal microbiota, owing to sampling difficulties. Indeed, it is worthwhile to emphasize that such cases are extremely rare but provide an almost unique opportunity to examine the human ileum at a very early stage of life. Few attempts have been made to isolate potential adherent probiotic bacteria directly from the human intestinal mucosa (the environment into which they are subsequently reintroduced and required to function). This study indicates the presence of two different probiotic strains (L. paracasei NFBC 338 and B. animalis subsp. lactis Bb12) in the upper intestinal tract at an early stage of human life, The ISME Journal Lactobacilli and bifidobacteria flora in infant ileum R Wall et al 90 which provides evidence for their ability to colonize the human small intestine. Acknowledgements This work was funded by SFI funds, and in part by the Irish Government under the National Development Plan 20002006 and by EU Project QLK1-2002-02362. Rebecca Wall is a student funded by the Alimentary Pharmabiotic Centre (APC). References Ahrne S, Lonnermark E, Wold AE, Aberg N, Hesselmar B, Saalman R et al. (2005). Lactobacilli in the intestinal microbiota of Swedish infants. Microbes Infect 7: 12561262. Aimutis WR. (1999). Microflora of the intestine/biology of Lactobacillus acidophilus. In: Robinson RK, Batt CA, Patel PD (eds). Encyclopedia of Food Microbiology, vol. 2. Academic Press, Publ.: London, UK, pp 13611365. Anderson DG, McKay LL. (1983). Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl Environ Microbiol 46: 549552. Bennet R, Nord CE. (1987). Development of the fecal anaerobic microflora after cesarean section and treatment with antibiotics in newborn infants. Infection 15: 332336. Benno Y, Mitsuoka T. (1986). Development of intestinal microflora in humans and animals. Bifidobacteria microflora 5: 1325. Bernet MF, Brassart D, Neeser JR, Servin AL. (1994). Lactobacillus acidophilus LA-1 binds to cultured human intestinal cell lines and inhibits cell-attachment and cell-invasion by enterovirulent bacteria. Gut 35: 483489. Chierici R, Fanaro S, Saccomandi D, Vigi V. (2003). Advances in the modulation of the microbial ecology of the gut in early infancy. Acta Paediatr Suppl 91: 5663. Cooperstock M, Zedd AJ. (1983). Intestinal flora of infants. In: Hentges DJ (eds). Human Intestinal Microflora in Health and Disease. Academic press: New York, pp 7999. Desmond C, Ross RP, Fitzgerald G, Stanton C. (2005). Sequence analysis of the plasmid genome of the probiotic strain Lactobacillus paracasei NFBC338 which includes the plasmids pCD01 and pCD02. Plasmid 54: 160175. Evans DF. (1998). Physicochemical environment of the colon. Eur J Cancer 7(Suppl. 2): S79S80. Evans DF, Pye G, Bramley R, Clark G, Dyson TJ, Hardcastle JD. (1988). Measurement of gastrointestinal pH profiles in normal ambulant human subjects. Gut 29: 10351041. Favier CF, Vaughan EE, De Vos WM, Akkermans ADL. (2002). Molecular monitoring of succession of bacterial communities in human neonates. Appl Environ Microbiol 68: 219226. Flourie B, Florent C, Jouany P, Thivend P, Etanchaud F, Rambaud JC. (1986). Colonic metabolism of wheat starch in healthy humans. Effects on fecal outputs and clinical symptoms. Gastroenterology 90: 111119. The ISME Journal Fuller R. (1989). Probiotics in man and animal. J Appl Bacteriol 66: 365378. Gardiner G, O��ullivan E, Kelly J, Auty MA, Fitzgerald G, Collins JK et al. (2000). Comparative survival rates of human-derived probiotic Lactobacillus paracasei and L. salivarius strains during heat treatment and spray drying. Appl Environ Microbiol 66: 26052612. Gardiner G, Ross RP, Collins JK, Fitzgerald G, Stanton C. (1998). Development of a probiotic cheddar cheese containing human-derived Lactobacillus paracasei strains. Appl Environ Microbiol 64: 21922199. Gewolb IH, Schwalbe RS, Taciak VL, Harrison TS, Panigrahi P. (1999). Stool microflora in extremely low birthweight infants. Arch Dis Child Fetal Neonatal 80: 167173. Heilig HG, Zoetendal EG, Vaughan EE, Marteau P, Akkermans AD, de Vos WM. (2002). Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16S ribosomal DNA. Appl Environ Microbiol 68: 114123. Juntunen M, Kirjavainen PV, Ouwehand AC, Salminen SJ, Isolauri E. (2001). Adherence of probiotic bacteria to human intestinal mucus in healthy infants and during rotavirus infection. Clin Diagn Lab Immunol 8: 293296. Kalliomaki M, Kirjavainen P, Eerola E, Kero P, Salminen S, Isolauri E. (2001). Distinct patterns of neonatal gut microflora in infants in whom atopy was and was not developing. J Allergy Clin Immunol 107: 129134. Kaufmann P, Pfefferkorn A, Teuber M, Meile L. (1997). Identification and quantification of Bifidobacterium species isolated from food with genus-specific 16S rRNA-targeted probes by colony hybridization and PCR. Appl Environ Microbiol 63: 12681273. Langendijk PS, Schut F, Jansen GJ, Raangs C, Kamphuis GR, Wilkinson MHF et al. (1995). Quantitative flourescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples. Appl Environ Microbiol 61: 30693075. Lee YK, Salminen S. (1995). The coming of age of probiotics. Trends Food Sci Technol 6: 241245. Malinen E, Matto J, Salmitie M, Alander M, Saarela M, Palva A. (2002). PCR-ELISA II: analysis of Bifidobacterium populations in human faecal samples from a consumption trial with Bifidobacterium lactis Bb-12 and a galacto-oligosaccharide preparation. Syst Appl Microbiol 25: 249258. Marteau P, Flourie B, Cherbut C, Correze L, Pellier P, Seylaz J et al. (1994). Digestibility and bulking effect of ispaghula husks in healthy humans. Gut 35: 17471752. Matsuki T, Watanabe K, Tanaka R, Fukuda M, Oyaizu H. (1999). Distribution of bifidobacterial species in human intestinal microflora examined with 16S rRNAgene-targeted species-specific primers. Appl Environ Microbiol 65: 45064512. Matsumiya Y, Kato N, Watanabe K, Kato H. (2002). Molecular epidemiological study of vertical transmission of vaginal Lactobacillus species from mothers to newborn infants in Japanese, by arbitrarily primed polymerase chain reaction. J Infect Chemother 8: 4349. Mitsuoka T. (1992). The human gastrointestinal tract. In: Wood BJB (ed). The Lactic Acid Bacteria, vol. 1. Elsevier: London, pp 69114. Lactobacilli and bifidobacteria flora in infant ileum R Wall et al 91 Mitsuoka T. (1996). Intestinal flora and human health. Asia Pacific J Clin Nutr 5: 29. Muyzer G, de Waal EC, Uitterlinden AG. (1993). Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59: 695700. Muyzer G, Smalla K. (1998). Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Van Leeuwenhoek 73: 127141. Prioult G, Fliss I, Pecquet S. (2003). Effect of probiotic bacteria on induction and maintenance of oral tolerance to beta-lactoglobulin in gnotobiotic mice. Clin Diagn Lab Immunol 10: 787792. Rada V. (1997). Detection of Bifidobacterium species by enzymatic methods and antimicrobial susceptibility testing. Biotechnol Tech 11: 909912. Sanders ME. (1994). Lactic acid bacteria as promotors of human health. In: Goldberg I (ed). Functional Foods: Designer Foods, Pharmafoods and Neutraceuticals. Chapman and Hall: New York, NY, pp 294322. Simpson PJ, Stanton C, Fitzgerald GF, Ross RP. (2003). Genomic diversity and relatedness of bifidobacteria isolated from a porcine cecum. J Bacteriol 185: 25712581. Stackebrandt E, Goebel BM. (1994). Taxonomic note: a place for DNADNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol 44: 846849. Stark PL, Lee A. (1982a). The bacterial colonization of the large bowel of preterm low-birth-weight neonates. J Hyg 89: 5967. Stark PL, Lee A. (1982b). The microbial ecology of the large bowel of breast-fed and formula-fed infants during their first year of life. J Med Microbiol 15: 189203. Tannock GW. (1994). The acquisition of the normal microflora of the gastrointestinal tract. In: Gibson SAW (ed). Human Health: The Contribution of Microorganisms. Springer-Verlag: London, pp 116. Tannock GW. (2001). Molecular assessment of intestinal microflora. Am J Clin Nutr 73: 410S414S. Temmermann R, Masco L, Vanhoutte T, Huys G, Swings J. (2003). Development and validation of a nested-PCRDenaturing gradient gel electrophoresis method for taxonomic characterization of bifidobacterial communities. Appl Environ Microbiol 69: 63806385. Tringe SG, Rubin EM. (2005). Metagenomics: DNA sequencing of environmental samples. Nat Rev Genet 6: 805814. Umesaki Y, Setoyama H. (2000). Structure of the intestinal flora responsible for development of the gut immune system in a rodent model. Microbes Infect 2: 13431351. Walter J, Hertel C, Tannock GW, Lis CM, Munro K, Hammes WP. (2001). Detection of Lactobacillus, Pediococcus, Leuconostoc, and Weisella species in human feces by using group-specific PCR primers and denaturing gradient gel electrophoresis. Appl Environ Microbiol 67: 25782585. Zhang L, Li N, Neu J. (2005). Probiotics for preterm infant. Neoreviews 6: 227232. The ISME JournalLoading Scribd Document...
Labmeeting is a web service for researchers. Sign up with your academic email address.
Individuals or corporations not affiliated with an academic institution can request a trial subscription.
